rs915125 chr6:81753659 C>T
- Sequence
aatacgatttggttttccacgaga[C/T]gtaaaagtaggagtttcaagaata
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 0.74 | 0.92 | 1.05 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
EMBL-EBI granulocyte percentage of myeloid white cells, monocyte percentage of white cells, neutrophil percentage of white cells
GRASP advanced age-related macular degeneration (geographic atrophy), coronary artery disease (cad), cystatin c in serum, prop taste detection threshold, triglycerides change with statins