rs916840 chr17:36110179 C>T
- Sequence
gtatggtggcatgtgcctgtagtc[C/T]cagctacatgggaggctgaggcag
- ASB in cell types
- HCT-116 (colon carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HCT-116 (colon carcinoma) | 2.14 | -0.82 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Breast_Mammary_Tissue, Colon_Transverse, Heart_Atrial_Appendage, Lung, Minor_Salivary_Gland, Muscle_Skeletal, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood