rs919471 chr15:33823977 C>T
- Sequence
gtaccctgggcagtagggagcata[C/T]gtgagctgcagtataattctttag
- ASB in cell types
- GM12890 (Lymphoblastoid Cell Lines)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 2.40 | 0.91 | 1.00 | -1.02 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP 2 hour glucose, ldl cholesterol, ldl cholesterol change with statins, refractive error, total cholesterol change with statins