rs919698 chr2:38555383 A>T
- Sequence
accaattcattttttaaatgccta[A/T]gatcactccctctcaccactagat
- ASB in cell types
- Peyer's patch thoracic aorta
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| Peyer's patch | -2.88 | 3.05 | 1.00 | |||
| thoracic aorta | -1.91 | 2.40 | 1.00 |
Items per page:
1 – 2 of 2