rs921407 chr7:32490586 A>T
- Sequence
tttaccatctcggcagatacccat[A/T]atgcccttgaagttttggagagac
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) HEK293 (embryonic kidney) MDM(monocyte derived macrophages) H929 (plasma cell myeloma)
- ASB for transcription factors
- ZFHX2_HUMAN NFXL1_HUMAN SRF_HUMAN ZN121_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZFHX2_HUMAN | 2.97 | n/a | 1.50 | n/a | n/a | |||
| NFXL1_HUMAN | -2.56 | 2.48 | 1.00 | n/a | n/a | |||
| SRF_HUMAN | 2.35 | -1.88 | 1.00 | n/a | No Hit | |||
| ZN121_HUMAN | 2.83 | -2.70 | 1.00 | n/a | No Hit | |||
| NR2C1_HUMAN | 2.42 | -2.16 | 1.00 | n/a | No Hit |
Items per page:
1 – 5 of 8
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Ovary, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Spleen, Stomach, Testis, Thyroid, Whole_Blood