rs923237 chr4:112508575 C>G
- Sequence
agggatcataaacacgtttgaaaa[C/G]gaagatgacctctttgtcacttgg
- ASB in cell types
- GM23248 iPS-derived chondrocytes
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM23248 | 1.83 | -1.78 | 1.00 | |||
| iPS-derived chondrocytes | 0.27 | 1.51 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Brain_Cerebellum, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Mucosa, Muscle_Skeletal, Testis, Thyroid