rs9257150 chr6:28764183 G>C
- Sequence
ctcagtggatcctcccacttcaac[G/C]gagggagagggagtctcgctctgt
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- EGR1_HUMAN PRD10_HUMAN NCOR1_HUMAN HDAC2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| EGR1_HUMAN | -0.33 | 1.54 | 3.00 | n/a | No Hit | |||
| PRD10_HUMAN | n/a | 1.11 | 3.00 | n/a | n/a | |||
| NCOR1_HUMAN | 0.24 | 2.37 | 3.00 | n/a | n/a | |||
| HDAC2_HUMAN | n/a | 2.47 | 3.00 | n/a | n/a | |||
| CEBPG_HUMAN | n/a | 1.79 | 3.00 | n/a | No Hit |
Items per page:
1 – 5 of 11
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, body mass index (bmi), height, infant head circumference, refractive error, total cholesterol change with statins
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Lung, Minor_Salivary_Gland, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Thyroid, Whole_Blood