rs9260118 chr6:29942399 C>T
- Sequence
ttcttttctccctctcccaaccta[C/T]gtagggtccttcatcctggatact
- ASB in cell types
- HCT-116 (colon carcinoma) cord blood-derived mononuclear cells
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HCT-116 (colon carcinoma) | 1.38 | 0.54 | 1.15 | |||
| cord blood-derived mononuclear cells | 2.49 | -2.10 | 1.00 |
Items per page:
1 – 2 of 2