rs9264638 chr6:31270541 G>A
- Sequence
ttgcatctctcttgggacactcca[G/A]cagcgcccatgtgaccatcctgag
- ASB for transcription factors
- RAD51_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RAD51_HUMAN | 2.60 | -4.06 | 1.33 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP body mass index (bmi), cystatin c in serum, hdl cholesterol, height, infant head circumference, ldl cholesterol, plasma beta-2 microglobulin levels, rheumatoid arthritis, sarcoidosis, total cholesterol, triglycerides, urinary albumin-to-creatinine ratio, waist hip ratio