rs9266218 chr6:31357338 A>G
- Sequence
aagttgggagaagaagtgaaactc[A/G]ggggagtggggaatccccaacgct
- ASB in cell types
- H929 (plasma cell myeloma) MDM(monocyte derived macrophages) macrophages form periferal blood GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| H929 (plasma cell myeloma) | 4.45 | n/a | 2.00 | |||
| MDM(monocyte derived macrophages) | -0.17 | 1.96 | 2.00 | |||
| macrophages form periferal blood | 1.38 | -2.92 | 2.00 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 0.82 | 0.44 | 2.04 |
Items per page:
1 – 4 of 4