rs9266219 chr6:31357339 G>T
- Sequence
agttgggagaagaagtgaaactca[G/T]gggagtggggaatccccaacgctg
- ASB in cell types
- MDM(monocyte derived macrophages) macrophages form periferal blood GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MDM(monocyte derived macrophages) | -0.17 | 1.93 | 2.00 | |||
| macrophages form periferal blood | 1.38 | -2.89 | 2.00 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 0.81 | 0.44 | 2.04 |
Items per page:
1 – 3 of 3