rs9266221 chr6:31357374 T>A
- Sequence
aatccccaacgctgcgcctcccca[T/A]tgcagacgcggccctcggagcctg
- ASB in cell types
- A549 (lung carcinoma) MCF7 (Invasive ductal breast carcinoma) WA01 (H1, human embryonic stem cells) GM12878 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- RFX5_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RFX5_HUMAN | 1.98 | -0.27 | 3.00 | n/a | No Hit |
Items per page:
1 – 1 of 1