rs9269078 chr6:32473102 C>T
- Sequence
agtcaacataataaagggaagtgc[C/T]gtatggggaaattattttagcatc
- ASB in cell types
- monocyte-derived macrophages from peripheral blood
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| monocyte-derived macrophages from peripheral blood | n/a | 2.69 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, advanced age-related macular degeneration (geographic atrophy), body mass index (bmi), cystatin c in serum, hdl cholesterol, ldl cholesterol, parkinsons disease, rheumatoid arthritis, rheumatoid arthritis (acpa-negative), rheumatoid arthritis (acpa-positive), total cholesterol, triglycerides, triglycerides change with statins, urinary albumin-to-creatinine ratio