rs927064 chr14:68966963 T>A
- Sequence
ccagcaccttggaatctgatgggc[T/A]gttagccaaagaaaaaacgcagct
- ASB in cell types
- AGS (gastric adenocarcinoma)
- ASB for transcription factors
- GATA4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GATA4_HUMAN | 2.65 | -4.88 | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP college completion, obesity with early age of onset (age >2), triglycerides, years of education
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Lung, Prostate, Spleen, Stomach, Thyroid, Whole_Blood