rs9272438 chr6:32637581 C>G
- Sequence
gggatgttctctggagctgaaaaa[C/G]agtaaattgaaggaaaagagataa
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- NFAC3_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| NFAC3_HUMAN | 3.07 | n/a | 3.00 | 0.50 | Weak Discordant |
Items per page:
1 – 1 of 1
Motif analysis
