rs927332 - ADASTRA v6.1.1

rs927332 chr6:6331640 T>C

Sequence: gcccaggggcccataagcggcttt[T/C]agttcttcattctatactgtctgg
ASB in cell types: GM12878 (female B-cells lymphoblastoid cell line) EOL-1 (Acute myeloid leukemia) 2588 (Lymphoblastoid Cell Lines) GM02630 (Fanconi anemi)
ASB for transcription factors: NFAC3_HUMAN TBX21_HUMAN STAG1_HUMAN SKIL_HUMAN
: Search SNPs nearby
View in UCSC Genome Browser
View in PheLiGe
0.05
FDR threshold
0
ES threshold

Color scale

-log10 FDR of Ref (T) ASB

-log10 FDR of Alt (C) ASB

Details

Transcription factors

Cell types

Uniprot ID	Effect size Ref	Effect size Alt	FDR Ref	FDR Alt	Mean BAD	Motif fold change	Motif concordance
NFAC3_HUMAN	-2.57	2.57	1.00	1.1·10^-9	1.00	n/a	No Hit
TBX21_HUMAN	-2.53	2.78	1.00	8.5·10^-9	1.00	n/a	No Hit
STAG1_HUMAN	-0.08	1.53	1.00	2.3·10^-4	1.00	n/a	n/a
SKIL_HUMAN	-3.13	2.19	1.00	1.0·10^-3	1.50	n/a	n/a
REQU_HUMAN	-3.13	2.19	1.00	1.1·10^-3	1.50	n/a	n/a

Items per page:

1 – 5 of 11

Motif analysis

ZNF24_HUMAN

Concordant

Genetic associations

EMBL-EBI gip levels in response to oral glucose tolerance test (120 minutes)

GRASP adiponectin levels, decrease in fev1 (in asthmatic participants), diabetic retinopathy in type 2 diabetes mellitus, factor xiii a subunit, ldl cholesterol, triglycerides

GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Brain_Spinal_cord_cervical_c-1, Liver, Nerve_Tibial, Whole_Blood