rs9277152 chr6:33053979 C>T
- Sequence
tagaacctaatcagttatggcaaa[C/T]agaagttacatccctgaatttgga
- ASB in cell types
- WA01 (H1, human embryonic stem cells) iPSC (induced pluripotent stem cells)
- ASB for transcription factors
- DUX4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| DUX4_HUMAN | 1.68 | -1.33 | 1.25 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Cells_Cultured_fibroblasts, Esophagus_Muscularis, Heart_Atrial_Appendage, Muscle_Skeletal, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood