rs9287082 chr1:167442246 A>T
- Sequence
tcaacctgtaaaacagggtgtggt[A/T]cccatctcactccacccctgcctg
- ASB in cell types
- THP-1 (acute monocytic leukemia) GM12892 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| THP-1 (acute monocytic leukemia) | 0.79 | 0.06 | 2.00 | |||
| GM12892 (female B-cells lymphoblastoid cell line) | 0.12 | 0.49 | 1.17 |
Items per page:
1 – 2 of 2