rs9287565 chr2:127012979 C>T
- Sequence
ttctcaccacttggtcagagaagt[C/T]attaataggtaacacgtgtacagc
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- MEF2B_HUMAN TBX21_HUMAN COT1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MEF2B_HUMAN | -2.78 | 3.02 | 1.00 | -2.71 | Discordant | |||
| TBX21_HUMAN | -1.58 | 1.83 | 1.00 | n/a | No Hit | |||
| COT1_HUMAN | -1.69 | 2.09 | 1.00 | n/a | No Hit |
Items per page:
1 – 3 of 3
Motif analysis
Genetic associations
GRASP diabetic retinopathy in type 2 diabetes mellitus, ldl cholesterol change with statins, lp-pla2 mass, obesity with early age of onset (age >2), total cholesterol change with statins