rs9287971 chr2:174067024 G>A
- Sequence
gatggggatgaagcttcagtgtaa[G/A]tctcttaggagaaaagtaaagccc
- ASB in cell types
- HepG2 (hepatoblastoma)
- ASB for transcription factors
- CREB1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CREB1_HUMAN | 1.01 | n/a | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP bipolar disorder, diabetic retinopathy in type 2 diabetes mellitus, major depressive disorder, rheumatoid arthritis, sporadic creutzfeldt-jakob disease, systolic blood pressure (sbp), tardive dyskinesia, variant creutzfeldt-jakob disease