rs9288754 chr3:195104361 T>C
- Sequence
gcaagcagaggagatggttctgag[T/C]cccaatcattcctcagcttaagtt
- ASB in cell types
- CTV-1 (Adult T acute lymphoblastic leukemia)
- ASB for transcription factors
- SPI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 0.23 | 1.01 | 1.27 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP age at death with kuru exposure, autism, comorbid depressive syndrome and alcohol dependence, diabetic retinopathy in type 2 diabetes mellitus, neuroblastoma (brain cancer), spine bone mineral density (bmd)