rs9288847 chr3:107272037 C>T
- Sequence
tgtccatctctgacactggataga[C/T]agtacccttctgcgtttttttaat
- ASB in cell types
- 2588 (Lymphoblastoid Cell Lines) KMS-11 (Plasma cell myeloma) HUVEC-C (HUVEC, umbilical vein endothelial cells)
- ASB for transcription factors
- STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG1_HUMAN | 0.81 | -0.02 | 1.03 | n/a | n/a |
Items per page:
1 – 1 of 1