rs9289625 chr3:141192362 G>A
- Sequence
cagtgagctgctgtggccgccccc[G/A]tttgctgctccaccactccttccg
- ASB in cell types
- THP-1 (acute monocytic leukemia) HMEC (human mammary epithelial cells) WA01 (H1, human embryonic stem cells) Peyer's patch
- ASB for transcription factors
- STAG2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG2_HUMAN | -0.12 | 1.85 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, maternal transmission distortion, normoxic and mild-hypoxic adaptation in populations residing at low and moderate altitudes, paternal transmission distortion, tetrology of fallot, transmission distortion
GTEx eQTL Artery_Tibial, Lung, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Thyroid, Whole_Blood