rs9289626 chr3:141192489 A>G
- Sequence
aggccttgcaggagagccaggctc[A/G]tggccgccccgcattgccctctgg
- ASB in cell types
- neural cell THP-1 (acute monocytic leukemia) GM12878 (female B-cells lymphoblastoid cell line) T47D (invasive ductal carcinoma)
- ASB for transcription factors
- RAD21_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RAD21_HUMAN | 0.96 | 0.70 | 1.39 | n/a | n/a |
Items per page:
1 – 1 of 1