rs9290474 chr3:173553894 C>A
- Sequence
tatgcagggcactgatttttggat[C/A]ggaaaggagactaaattttccccc
- ASB in cell types
- T47D (invasive ductal carcinoma) GM12892 (female B-cells lymphoblastoid cell line) Kelly (neuroblastoma) WA09 (embryonic stem cells)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| T47D (invasive ductal carcinoma) | 2.29 | n/a | 3.78 | |||
| GM12892 (female B-cells lymphoblastoid cell line) | -1.23 | 1.78 | 1.00 | |||
| Kelly (neuroblastoma) | 0.03 | 1.14 | 2.00 | |||
| WA09 (embryonic stem cells) | 1.76 | 0.16 | 1.33 | |||
| GM19099 (female B-cells Lymphoblastoid Cell Lines) | -1.01 | 1.10 | 1.00 |
Items per page:
1 – 5 of 5