rs929086 chr22:45608900 G>A
- Sequence
ttccagcatgattattccaattgg[G/A]atttaggaggactgggcattctcc
- ASB in cell types
- primary human neonatal keratinocytes
- ASB for transcription factors
- TEAD1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TEAD1_HUMAN | n/a | 2.59 | 1.00 | 4.26 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
