rs9291662 chr4:18077894 G>A
- Sequence
taatttgaacaatgttatttgcac[G/A]ctacttctaaatttagtgcttttc
- ASB in cell types
- EOL-1 (Acute myeloid leukemia)
- ASB for transcription factors
- SMRC1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SMRC1_HUMAN | 2.71 | -1.91 | 2.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, alcohol behavior (heaviness of drinking factor score), college completion, imprinting effects on cleft lip, ldl cholesterol, ldl cholesterol change with statins, rheumatoid arthritis, years of education