rs9292557 chr5:34609177 T>C
- Sequence
agccacagtagagggaaatagtag[T/C]gagaatatcccctttatctccaag
- ASB in cell types
- HEK293 (embryonic kidney)
- ASB for transcription factors
- ZN692_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZN692_HUMAN | n/a | 2.20 | 3.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, alzheimers disease, aortic valve calcium, hdl cholesterol, neuroblastoma (brain cancer), paternal transmission distortion, resistance to kuru in aged women despite likely exposure, rheumatoid arthritis, serum creatinine, tetrology of fallot, transmission distortion