rs9293635 chr5:74944039 A>C
- Sequence
taacttaggagaagaaactaaaac[A/C]ttagtaggactctgagaaagtatt
- ASB in cell types
- pancreas GM18505 (female B-cells Lymphoblastoid Cell Lines) GM19240 (B cells Lymphoblastoid Cell Lines) GM10847 (female B-cells Lymphoblastoid Cell Lines)
- ASB for transcription factors
- CTCF_HUMAN STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.50 | 0.04 | 1.47 | n/a | No Hit | |||
| STAG1_HUMAN | 1.33 | -0.09 | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, college completion, cystatin c in serum, diabetic retinopathy in type 2 diabetes mellitus, hdl cholesterol, ldl cholesterol