rs9293757 chr5:78628197 C>T
- Sequence
aatgccatcttgctgtgataaaga[C/T]ctcaaaagggctaatgaaattatc
- ASB in cell types
- iPS-derived chondrocytes
- ASB for transcription factors
- RARA_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RARA_HUMAN | 1.13 | 0.20 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP abnormal involuntary movement scale, alzheimers disease, comorbid depressive syndrome and alcohol dependence, hypertension (early onset hypertension), recurrent major depressive disorder, serum creatinine, simpson-angus scale