rs9294087 chr6:77815001 G>T
- Sequence
tctgtgcccactgtaccaaatagt[G/T]cgagctcatttcttcattttaagc
- ASB in cell types
- D283 Med (medulloblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| D283 Med (medulloblastoma) | 1.35 | -0.43 | 1.06 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), body mass index (bmi), femoral neck bone mineral density (bmd), homa-b, ldl cholesterol change with statins, severe diabetic retinopathy, total cholesterol change with statins