rs9295337 chr6:166383177 C>T
- Sequence
cggctggggctgggccggggctgg[C/T]aggcggttgctaggctccagcggc
- ASB in cell types
- HepG2 (hepatoblastoma) NCI-H2171 (small cell lung carcinoma) GM8330-8-derived NPC
- ASB for transcription factors
- RBM25_HUMAN CHD8_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RBM25_HUMAN | 1.80 | 0.67 | 3.00 | n/a | n/a | |||
| CHD8_HUMAN | 2.35 | -1.88 | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Cerebellar_Hemisphere, Cells_Cultured_fibroblasts, Colon_Transverse, Muscle_Skeletal, Testis