rs9296207 chr6:37055868 T>C
- Sequence
acaggtggcgactttaggcctgca[T/C]agatggctggggtgaggcaattca
- ASB in cell types
- TMD8 (diffuse large B-cell lymphoma)
- ASB for transcription factors
- ITF2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ITF2_HUMAN | -1.47 | 2.30 | 1.75 | n/a | No Hit |
Items per page:
1 – 1 of 1