rs9296656 chr6:51531946 C>A
- Sequence
aggggttgggcatctaccacctcc[C/A]taaatgtaggtcacttggagcagg
- ASB in cell types
- 2588 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| 2588 (Lymphoblastoid Cell Lines) | 1.69 | -0.88 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP cystatin c in serum, hdl cholesterol, hip bone mineral density (bmd), salmonella-induced pyroptosis, serum creatinine, spine bone mineral density (bmd), sporadic creutzfeldt-jakob disease