rs9296704 chr6:53172269 G>A
- Sequence
cacctttgcaggtaccacaatcct[G/A]ggtcatcactttaaacccatgtcc
- ASB in cell types
- GM02610 (Lymphoblastoid Cell Lines) GM18505 (female B-cells Lymphoblastoid Cell Lines) LUHMES (lund human mesencephalic cells)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM02610 (Lymphoblastoid Cell Lines) | 0.60 | -0.28 | 1.00 | |||
| GM18505 (female B-cells Lymphoblastoid Cell Lines) | -0.60 | 0.62 | 1.00 | |||
| LUHMES (lund human mesencephalic cells) | -0.41 | 1.70 | 1.00 |
Items per page:
1 – 3 of 3