rs9296792 chr6:55528889 G>A
- Sequence
gcatatgacccaaactcttctatt[G/A]taaatgcaggcaagacatttgagt
- ASB in cell types
- KMS-11 (Plasma cell myeloma) OCI-LY7 (diffuse large B-cell lymphoma) THP-1 (acute monocytic leukemia)
- ASB for transcription factors
- ELF1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ELF1_HUMAN | 1.91 | -0.17 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, mitral annular calcium, suicide attempts in bipolar disorder (substance free)
GTEx eQTL Artery_Coronary, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Nucleus_accumbens_basal_ganglia, Testis