rs9297025 chr6:16974472 A>G
- Sequence
tcattcatgaacattttttttctc[A/G]tgtcatgtcaggaaaagacacaca
- ASB in cell types
- neural cell
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| neural cell | 0.02 | 1.13 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, college completion, cystatin c in serum, hdl cholesterol, height, total cholesterol, years of education