rs9297586 chr8:118415108 C>T
- Sequence
aaatcccaagtcatgcctccaggg[C/T]gagtatcctacatttagcctgtgt
- ASB in cell types
- erythroid progenitors Kelly (neuroblastoma) spleen
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| erythroid progenitors | n/a | 2.39 | 2.50 | |||
| Kelly (neuroblastoma) | 0.24 | 1.08 | 1.00 | |||
| spleen | -0.26 | 1.90 | 1.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP age at death with kuru exposure, diastolic blood pressure (dbp), systolic blood pressure (sbp), tetrology of fallot