rs9297664 chr8:122786245 T>G
- Sequence
cttgcctttttcctgacctttggg[T/G]ctcctgggccctagctgcagctcc
- ASB in cell types
- breast tumor
- ASB for transcription factors
- ESR1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ESR1_HUMAN | n/a | 3.31 | 2.00 | -1.56 | Weak Discordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP 2 hour glucose, advanced age-related macular degeneration (geographic atrophy), hdl cholesterol change with statins, neuroblastoma (brain cancer)