rs930094 chr16:9408424 A>G
- Sequence
tccctgggagtccttgcttgcaca[A/G]atgtgtgggatagactcccgctgt
- ASB in cell types
- D341 Med (medulloblastoma)
- ASB for transcription factors
- OTX2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| OTX2_HUMAN | -0.20 | 1.47 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP alzheimers disease, hdl cholesterol, mitral annular calcium, variant creutzfeldt-jakob disease