rs931574 chr3:123380118 C>T
- Sequence
tagaagtaatgaggaaatgtccct[C/T]cccagtcttctcagaaacagggag
- ASB in cell types
- CTV-1 (Adult T acute lymphoblastic leukemia) monocyte-derived dendritic cells
- ASB for transcription factors
- SPI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 1.50 | 0.21 | 1.68 | 3.91 | Discordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP bipolar disorder, hdl cholesterol, primary rhegmatogenous retinal detachment, pulse pressure, total cholesterol change with statins