rs931587 chr12:54680521 G>A
- Sequence
ggctagcagggtagcatgatcttg[G/A]caggaatggaggaatccgaggtgt
- ASB in cell types
- D54 (H54, Human glioblastoma) esophagus squamous epithelium upper lobe of left lung
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| D54 (H54, Human glioblastoma) | -1.00 | 2.22 | 2.00 | |||
| esophagus squamous epithelium | -0.04 | 1.97 | 1.00 | |||
| upper lobe of left lung | 0.68 | 2.71 | 1.00 |
Items per page:
1 – 3 of 3