rs933269 chr22:19943573 C>T
- Sequence
aaaagatcgtttgagcctgggagg[C/T]ggaggctgccatgagccatgatct
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- ATF4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ATF4_HUMAN | n/a | 1.89 | 4.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Heart_Atrial_Appendage, Liver, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Spleen, Testis