rs933271 chr22:19943884 T>C
- Sequence
tggttactttctggagagagcatg[T/C]ggcatgcaggagctggaggggggg
- ASB in cell types
- K562 (myelogenous leukemia) CTV-1 (Adult T acute lymphoblastic leukemia) NALM-6 (adult B acute lymphoblastic leukemia)
- ASB for transcription factors
- NR2C1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| NR2C1_HUMAN | n/a | 2.50 | 4.00 | n/a | No Hit |
Items per page:
1 – 1 of 1