rs933552 chr12:7938107 A>C
- Sequence
atagtatctaggcttttttggagg[A/C]ggaatatcaactatcaaattccta
- ASB in cell types
- GM10847 (female B-cells Lymphoblastoid Cell Lines) MCF7 TamR (invasive ductal breast carcinoma Tamoxifen resistant)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.66 | -0.72 | 1.30 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP comorbid depressive syndrome and alcohol dependence, fasting insulin, homa-b, homa-ir, ldl cholesterol change with statins, rheumatoid arthritis, transmission distortion, triglycerides