rs934278 chr2:55843217 G>A
- Sequence
gagagtctttttcatggagattgt[G/A]tgacggcacattggaggaaattcc
- ASB in cell types
- HEK293 (embryonic kidney) CFPAC-1(pancreatic ductal adenocarcinoma) MOLM14 (Adult acute myeloid leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.61 | 0.87 | 1.10 | |||
| CFPAC-1(pancreatic ductal adenocarcinoma) | 1.46 | 0.46 | 2.00 | |||
| MOLM14 (Adult acute myeloid leukemia) | 1.09 | 0.18 | 1.00 |
Items per page:
1 – 3 of 3