rs934498 chr4:4260279 G>T
- Sequence
aaagataaacacagagatggaaat[G/T]ggagtaatactaaatttcggtgca
- ASB in cell types
- foreskin keratinocyte LNCaP C4-2B (prostate carcinoma) GM18486 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 1.36 | -4.36 | 2.67 | |||
| LNCaP C4-2B (prostate carcinoma) | -1.79 | 2.73 | 2.00 | |||
| GM18486 (Lymphoblastoid Cell Lines) | -0.63 | 0.92 | 1.00 |
Items per page:
1 – 3 of 3