rs935200 chr17:79974992 C>T
- Sequence
ttgacctggggttggggccacccc[C/T]gcagccactgcgccctctataggt
- ASB in cell types
- GM19239 (male B-cells lymphoblastoid cell line) GM18526 (B – cells Lymphoblastoid Cell Lines) GM10847 (female B-cells Lymphoblastoid Cell Lines) epithelial cell of prostate
- ASB for transcription factors
- CTCF_HUMAN STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.18 | 1.39 | 1.52 | n/a | No Hit | |||
| STAG1_HUMAN | -0.26 | 2.72 | 1.24 | n/a | n/a |
Items per page:
1 – 2 of 2