rs935657 chr2:45836873 G>C
- Sequence
tcatctttttcagaccctgtccct[G/C]ttgcccttttgcctctctccacgc
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) monocyte-derived dendritic cells germinal center B-cells
- ASB for transcription factors
- CBP_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CBP_HUMAN | 0.56 | 3.03 | 2.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), body mass index (bmi), ldl cholesterol, total cholesterol