rs936025 chr19:50237667 T>C
- Sequence
attgcagagaatctacctcgtcgc[T/C]gtccacagggtggcgctagtttcc
- ASB in cell types
- GM19240 (B cells Lymphoblastoid Cell Lines) glioblastoma cells 2588 (Lymphoblastoid Cell Lines) TMD8 (diffuse large B-cell lymphoma)
- ASB for transcription factors
- STAG1_HUMAN ITF2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG1_HUMAN | 1.27 | 1.46 | 1.63 | n/a | n/a | |||
| ITF2_HUMAN | 2.17 | -1.21 | 2.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP homa-b, serum dehydroepiandrosterone sulphate (dheas), total cholesterol change with statins, triglycerides